Saltar al contenido principal

Registration is now open for this year's LibreFest! Join us virtually the week of July 13.

Register here
LibreTexts Español

13.2: Codificación de barras (Actividad)

  • Page ID
    56307
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    Código de barras de ADN de muestras

    1. Colocar la muestra en un tubo limpio de 1.5 mL.
    2. Agregar 100 μl de solución de lisis nuclear al tubo.
    • Gire una mano de mano de plástico limpia contra la superficie interna.
    1. Agregue 500 μl más de solución de lisis nuclear al tubo.
    2. Incubar el tubo en baño de agua o bloque térmico a 65°C durante 5-15 minutos.
    3. [Opcional] Agregar 200 μl de solución de precipitación de proteínas a cada tubo incubar en hielo durante 5 minutos.
    4. Centrifugar durante 4 minutos a velocidad máxima para sedimentar proteínas y restos celulares.
    5. Transferir 600 μl de sobrenadante a un tubo limpio etiquetado.
    6. Añadir 600 μl de isopropanol.
    7. Centrifugar durante 2 minutos a velocidad máxima para sedimentar el ADN.
    8. Vierta el sobrenadante y agregue 600 μl de etanol al 70% para lavar el sedimento.
    9. Centrifugue el tubo durante 2 minutos a velocidad máxima y retire con cuidado la solución.
    10. Secar el pellet al aire durante 10 minutos y agregar 100 μl de la solución de rehidratación de ADN (TE).
    11. Incubar el ADN a 65°C durante 5-10 minutos para disolverlo.
    12. Obtener un tubo de PCR que contiene perlas de PCR listas para usar. Etiquete el tubo con su número de identificación.
    13. Use una micropipeta con una punta fresca para agregar 23 μL de una de las siguientes mezclas de imprimación/colorante de carga a cada tubo. Permita que las perlas se disuelvan por 1 minuto.
    • Plantas: cebadores RbcL (RbClaf/RbCLA rev)
    • Peces: cebadores COI (VF2_T1/ FishF2_T1/ FishR2_T1/ Fr1d_T1)
    • Insectos: (Lepf1_t1/ LePr1_T1)
    1. Agrega 2 μl de tu ADN directamente en la mezcla apropiada de imprimación/colorante de carga.
    2. Colocar los tubos en un termociclador.
    3. Vierta 2% de agarosa en el aparato de fundición en el refrigerador.
      1. Se necesitaban hacer 2 geles por clase → 100ml de TBE con agarosa 2g
      2. Agregue 5 μl de solución segura SYBR a la agarosa fundida antes de colar.
      3. Coloca 2 juegos de peines en el gel → en un extremo y en el medio.
    4. Cargar muestras de escalera de ADN y PCR.
    5. Ejecutar el gel a 120V durante 30 minutos.
    6. Visualice en el transiluminador UV.
    7. Documente con una cámara.
    8. Enviar amplicones de muestras verificadas para secuenciación.
    • Gen RbcL vegetal
      • RbCLAF 5'- ATGTCACCACAAACAGAGACTAAAGC-3' (cebador directo)
      • RbClar 5'- GTAAAATCAAGTCCACCRCG-3' (cebador inverso)
    • Gen coi animal
      • LePF1 5'- ATTCAACCAATCAATAAAAGATATTGG -3' (cebador directo)
      • LePr1 5'- TAAACTTCGGATGTCCAAAAAATCA-3' (cebador inverso)
      • vf1f 5'- TCTCAACCAACCACAAAGACATTGG-3' (cebador directo)
      • vf1r 5'- TAGACTTCGGGTGGCCAAAGAATCA-3' (cebador inverso)

    This page titled 13.2: Codificación de barras (Actividad) is shared under a CC BY-NC-SA 4.0 license and was authored, remixed, and/or curated by Bio-OER.