Saltar al contenido principal
LibreTexts Español

3.1.3: Realización del protocolo de PCR de cadena principal linealizada

  • Page ID
    57434
    • Nathan Reyna, Ruth Plymale, and Kristen Johnson
    • Ouachita Babtist University and University of New Hampshire

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    Protocolo de PCR para cadenas principales linealizadas

    *Todos los procedimientos copiados o modificados del protocolo lineal backbone de iGem y el protocolo Q5 ® Hot Start High-Fidelity 2X Master Mix Protocol *

    1. Crecer parte BBA_J04450 a partir del plásmido iGEM. Crecer 1 parte por cada estructura principal diferente (pSB1c3, PSB1k3, PSB1t3, PSB1a3)
    2. Aislar el ADN del cultivo y obtener la concentración de ADN (vía Denovix/Nanodrop/Qubit)
    3. Hacer la mezcla de reacción de PCR para amplificación plasmídica usando la siguiente tabla:

    *Mantenga todo en hielo y etiquete los tubos de PCR antes de comenzar. Siempre agregue la ADN polimerasa por último ya que se hundirá hasta el fondo. Utilice la\(\mu L\) reacción 50 para esqueletos lineales. Por lo general, 1µL de ADN es suficiente. *

    Componente 25 uL Reacción Reacción de 50 uL Concentración Final
    Mezcla maestra 2X de alta fidelidad Q5 12.5 uL 25 uL 1X
    10 uM de cebador directo (SB-Prep-3P-1) 1.25 uL 2.5 uL 0.5 uM
    10 uM Imprimación inversa (SB-Prep-2EA) 1.25 uL 2.5 uL 0.5 uM
    ADN molde (pSB1c3, A3, K3, T3) Variable 10 ng < 1,000 ng
    Agua Destilada hasta 25 uL hasta 50 uL

    Cebadores para la cadena principal lineal:

    SB-prep-3p-1 gccgctgcagtccggcaaaaaa,

    SB-Prep-2ea atgaattccagaaatcatccttagcg

    Paso Temperatura Tiempo
    Desdesnaturalización inicial 98°C 30 segundos
    25-35 Ciclos 98°C 10 segundos
    66°C 30 segundos
    72°C 3 minutos
    Extensión Final 72°C 1.5 minutos
    Hold 4°C
    1. Digestión:
      1. 4 uL 10X NEB Buffer 2.1
      2. 1 uL EcoRi-HF
      3. PSTi de 1 uL
      4. 1 ul de DpnI (Se usa para digerir cualquier ADN molde de la producción)
      5. 25 uL PCR Producto plasmídico linealizado (usar la cantidad total del producto de PCR purificado)
      6. Digerir a 37 °C durante 3 horas
      7. Matanza por calor a 80 °C durante 20 minutos

    * Elija una pieza con un inserto relativamente grande que sepa que es correcto y tenga mucho de sobra. Digerir 300 ng del plásmido con EcoRI y PstI de acuerdo con la instrucción de Doble Digestión. Inactivar por calor la muestra*

    1. Ligadura:
      1. 1 ul de esqueleto plasmídico digerido con E/P purificado (25 ng)
      2. Cantidad equimolar de fragmento digerido con E/P (2 uL)
      3. 1 ul de tampón de ADN ligasa T4
      4. 0,5 ul de ADN ligasa T4
      5. Agua destilada hasta 10 uL
      6. Ligar a 16°C durante 30 minutos
      7. Matanza por calor a 80 °C durante 20 minutos

    *Consulte el protocolo “Transformación celular: Transformación Zippy de células competentes en Z” anterior para obtener información sobre cómo realizar una transformación*

    Cualquier colonia en las placas de control solo con la estructura principal representa el fondo del proceso de ensamblaje de tres antibióticos. Si hay demasiados, esto podría presentar un problema durante los proyectos estudiantiles.

    Muchas colonias en la cadena principal+placas de inserción indican que las cadenas principales se amplifican y cortan de manera efectiva para ser ligadas a insertos de corte E/P.


    This page titled 3.1.3: Realización del protocolo de PCR de cadena principal linealizada is shared under a not declared license and was authored, remixed, and/or curated by Nathan Reyna, Ruth Plymale, and Kristen Johnson.