Saltar al contenido principal
LibreTexts Español

5: Genética poblacional de divergencia y sustitución molecular

  • Page ID
    58105
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    “La historia es sólo una maldita cosa tras otra”. -a veces atribuido a Arnold Toynbee

    Hay más de un\(30\) millón de sustituciones de pares de bases entre humanos y chimpancés, sitios donde los humanos portan un alelo y los chimpancés otro en ubicaciones ortólogas. Estos cambios han ocurrido en los siete millones de años más o menos desde la última vez que el humano y el chimpancé compartieron un ancestro común Otras sustituciones se comparten entre la especie hermana humana y chimpancé con exclusión del gorila, sin embargo, otras se comparten entre humanos, chimpancés y gorila pero no orangs. La evolución a largo plazo, desde la perspectiva molecular, es solo una maldita sustitución tras otra. Estas sustituciones representan cambios en solo un pequeño porcentaje de sitios en todo el genoma, ya que compartimos la mayor parte de nuestro genoma, nuestra historia evolutiva y nuestra biología con los otros grandes simios. Cada una de las sustituciones debe haber surgido como una mutación en la población, diseminada a través de la población como un polimorfismo antes de llegar finalmente a la fijación. ¿Qué fuerzas impulsaron la propagación de estos alelos a través de la población para convertirse en sustituciones?

    Humano accacagcatttgttagttactgccaagaagcctgtatctgtagggtaaaatcctcgctgaagtgggttg
    Chimpancé ... g... c...
    Gorila ... cc...
    Orangután ... c... c... c...
    Gibbon ... c... —...
    Macaco cangrejo g... gg... c... c.. t.t...

    Muchas sustituciones fueron impulsadas por la selección, ya que sin duda ha habido mucha evolución adaptativa fenotípica adaptativa en grandes simios. Sin embargo, estos cambios adaptativos pueden ser una pequeña minoría de todas las subsituaciones, para un inicio muchas de estas sustituciones han ocurrido en ADN no codificante sin efecto funcional conocido. Por lo tanto, es razonable la posición inicial de que la mayoría de las sustituciones en todo el genoma pueden ser neutras. ¿Cómo podemos esperar identificar regiones en proceso de divergencia adaptativa? ¿Cómo podríamos esperar abordar la afirmación de que muchas sustituciones cambiantes de aminoácidos también son neutras, como postula la teoría neutra de la evolución molecular? Una manera de avanzar es entender qué predice la teoría neutra para la tasa de substición molecular, y luego desarrollar formas de probar estas ideas.

    Ilustración de Benjamin Waterhouse Hawkins de “Evidence as to Man's Place in Nature” de Huxley (1863). Imagen de la wikimedia, dominio público.
    Ilustración de Benjamin Waterhouse Hawkins de “Evidence as to Man's Place in Nature” de Huxley (1863). Imagen de la wikimedia, dominio público.

    El proceso de Sustitución Neutral.

    Entonces, ¿cómo ocurren las sustituciones neutras? Es muy poco probable que un alelo neutro raro se desplace accidentalmente a la fijación; lo más probable es que dicho alelo se pierda eventualmente de la población. Sin embargo, las poblaciones experimentan una afluencia grande y constante de alelos raros debido a la mutación, por lo que incluso si es muy poco probable que un alelo individual se fije dentro de la población, algunos alelos neutros se fijarán por casualidad. Así que tendremos que entender la probabilidad de que una mutación neutra corrija, y luego cómo podemos pensar acerca de la tasa de sustituciones que se acumulan con el tiempo.

    probabilidad de la eventual fijación de un alelo neutro

    A cada alelo inicialmente presente en una pequeña población diploide se le da un color diferente para que podamos rastrear a sus descendientes a lo largo del tiempo. Para la novena generación, todos los alelos presentes en la población pueden rastrear su ascendencia hasta el alelo naranja.
    A cada alelo inicialmente presente en una pequeña población diploide se le da un color diferente para que podamos rastrear a sus descendientes a lo largo del tiempo. Para la novena generación, todos los alelos presentes en la población pueden rastrear su ascendencia hasta el alelo naranja.

    Un alelo que alcanza la fijación dentro de una población es un antepasado de toda la población. En una generación en particular solo puede haber un solo alelo que todos los demás alelos en el locus en una generación posterior puedan afirmar como ancestro (Ver Figura\ ref {fig:subs_simulation}). En un locus neutro, el alelo real no afecta el número de descendientes que tiene el alelo (esto se desprende de la definición de neutralidad: los alelos neutros no dejan más o menos descendientes en promedio que otros alelos neutros). Una forma equivalente de afirmar esto es que las etiquetas alélicas no afectan nada; así los alelos son intercambiables. Como consecuencia de ser intercambiable, cualquier alelo es igualmente probable que sea el antepasado de toda la población. En una población diploide de tamaño\(N\), hay\(2N\) alelos, todos los cuales son igualmente propensos a ser el antepasado de toda la población en algún momento posterior. Entonces, si nuestro alelo está presente en una sola copia, lo es la posibilidad de que sea el antepasado de toda la población en alguna generación futura\(\frac{1}{(2N)}\), es decir, la posibilidad de que nuestro alelo neutro finalmente se fije lo es\(\frac{1}{(2N)}\). En la Figura\ ref {fig:subs_simulation}, nuestro alelo naranja en la primera generación es uno de los 10 alelos de diferentes colores, y así tiene la\(1/10\) posibilidad de ser el antepasado de toda la población en algún momento posterior (y en esta simulación sí se convierte en el ancestro común, hacia el noveno generación).

    Más generalmente, si nuestro alelo neutro está presente en\(i\) copias en la población, de\(2N\) alelos, la probabilidad de que este alelo se vuelva fijo es\(\frac{i}{(2N)}\), es decir, la probabilidad de que un alelo neutro finalmente se fije viene dada simplemente por su frecuencia ( \(p\)) en la población. (También podemos derivar este resultado dejando\(Ns \rightarrow 0\) en Ecuación\ ref {eqn:prob_fixed}, un resultado que encontraremos más adelante.)

    ¿Cuánto tiempo tarda en promedio que tal alelo se solucione dentro de nuestra población? Al desarrollar la Ecuación\ ref {TMRCA_neutral} hemos visto que toma en promedio\(4N\) generaciones para que una gran muestra de alelos remonten su ascendencia hasta un solo alelo ancestral común más reciente. Cualquier cambio de par de bases únicas que surja como mutación única en un locus, y fijado en la población, debe haber estado presente en la secuencia transmitida por el ancestro común más reciente de la población en ese locus. Por lo tanto, se deben tomar aproximadamente\(4N\) generaciones para que un alelo neutro presente en una sola copia dentro de la población se fije. Este argumento puede hacerse más preciso, pero en general aún encontraríamos que se necesitan\(\approx 4N\) generaciones para que un alelo neutro pase de su introducción a la fijación con la población.

    Tasa de sustitución de alelos neutros

    Una sustitución entre poblaciones que no intercambian flujo génico es simplemente un evento de fijación dentro de una población. Por lo tanto, la tasa de sustitución es la tasa a la que se fijan los nuevos alelos en la población, de manera que la tasa de sustitución a largo plazo es la tasa a la que surgen mutaciones que eventualmente se fijarán dentro de nuestra población.

    Supongamos, a partir de nuestra discusión de la teoría neutra de la evolución molecular, que solo hay dos clases de cambios mutacionales que pueden ocurrir con una región, mutaciones altamente deletéreas y mutaciones neutras. Una fracción\(C\) de todos los cambios mutacionales son altamente nocivos y no pueden contribuir a la sustitución ni al polimorfismo. La otra\(1-C\) fracción de mutaciones son neutras. Si nuestra tasa de mutación total es\(\mu\) por alelo transmitido por generación, entonces un total de mutaciones\(2N \mu (1-C)\) neutras ingresan a nuestra población en cada generación.

    Cada una de estas mutaciones neutras tiene una\(\frac{1}{(2N)}\) probabilidad de llegar a fijarse en la población. Por lo tanto, la velocidad a la que surgen mutaciones neutras que eventualmente se fijan dentro de nuestra población es

    \[2N\mu(1-C)\frac{1}{2N} = \mu(1-C)\]

    Así, la tasa de sustitución, bajo un modelo donde los alelos recién surgidos son altamente deletéreos o neutros, viene dada simplemente por la tasa de mutación de los alelos neutros, i.e\(\mu(1-C)\).

    Considere un par de especies que han divergido por\(T\) generaciones, es decir, secuencias ortólogas compartidas entre la última especie que compartió un ancestro común hace\(T\) generaciones. Si estas especies han mantenido una constante\(\mu\) a lo largo de ese tiempo, habrán acumulado un promedio de

    \[2\mu(1-C)T \label{eqn:moleclock}\]

    sustituciones neutras. Esto supone que\(T\) es mucho más largo que el tiempo que lleva fijar un alelo neutro, de tal manera que el número total de alelos introducidos en la población que eventualmente se fijará es el número total de sustituciones.

    Este es un resultado realmente bonito ya que el tamaño de la población se ha cancelado por completo fuera de la tasa de sustitución neutra. No obstante, hay otra manera de ver esto de una manera más directa. Si miro una secuencia en mí comparada con, digamos, un chimpancé en particular, estoy viendo las mutaciones que se han producido en nuestras dos líneas germinales desde que se separaron hace\(T\) generaciones. Dado que los alelos neutros no alteran la probabilidad de su transmisión a la siguiente generación, simplemente estamos mirando las mutaciones que han ocurrido en\(2T\) generaciones dignas de transmisiones. Así, el número promedio de diferencias mutacionales neutras que separan a nuestro par de especies es simplemente\(2\mu (1-C) T\).

    Implicaciones para el Reloj Molecular.

    Bajo este modelo siguen una serie de observaciones, de la Ecuación\ ref {eqn:moleclock}. La primera es que un determinante primario de los patrones de evolución molecular en una región genómica es el nivel de restricción (\(C\)). Este patrón generalmente parece mantenerse empíricamente: las regiones no codificantes a menudo evolucionan más rápidamente que las regiones codificantes, las sustituciones sinónimos se acumulan más rápido que las no sinónimas y las sustituciones no sinónimas se acumulan más rápido en proteínas menos vitales que aquellas que son absolutamente necesarias para el desarrollo temprano. Por ejemplo, los fibrinopéptidos evolucionan de una manera menos restringida que el gen del citocromo c, ver Figura\ ref {fig:Dickerson_mole_clock}. Obsérvese que esta predicción de restricción no es una predicción única del modelo neutro, por ejemplo, las regiones menos restringidas también pueden evolucionar mejor de manera adaptativa. Sin embargo, es una visión general fantásticamente útil, por ejemplo, nos permite detectar regiones no codificantes putativamente funcionales buscando regiones genómicas que tengan niveles muy bajos de divergencia entre especies relacionadas distantemente.

    fig-ch01_patchfile_01.jpg
    Los números de sustituciones en tres proteínas, corregidos por múltiples aciertos, entre varios pares de grupos trazados contra el tiempo en que estos grupos compartieron un ancestro común en el registro fósil. Datos de. Las líneas dan la regresión lineal a través del origen para cada proteína. La pendiente de la regresión se da junto al nombre de la proteína. Vea quién revisitó este estudio clásico y confirmó las conclusiones.

    La segunda visión importante, y crítica para el desarrollo de la teoría neutra, es que la Ecuación\ ref {eqn:moleclock} es aparentemente consistente con la hipótesis de un reloj molecular de proteínas sorprendentemente constante. El reloj molecular proteico es la observación de que para algunas proteínas existe una relación lineal entre el número de sustituciones no sinónimas (NS) y la última vez que la especie compartió un ancestro común en el registro fósil. proporcionó un ejemplo temprano de esta observación (Figura\ ref {fig:Dickerson_Mole_ clock}), comparando diversos organismos cuyas secuencias moleculares estaban disponibles para él. Por ejemplo, encontró que los humanos y las serpientes de cascabel, quienes por última vez comparten un ancestro común en el registro fósil alrededor de 300 millones de años, están separados aproximadamente por sustituciones\(15\) NS por\(100\) sitios en la proteína del citocromo c. En tanto, los humanos y el cazón, que divergieron alrededor de 400 millones de años, están separados por sustituciones\(19\) NS por\(100\) sitios en este gen.

    imagen

    En la Ecuación\ ref {eqn:moleclock}, si duplicamos la cantidad de tiempo separando un par de especies\(T\), duplicamos el número de sustituciones predichas. Obsérvese que para que esto sea cierto se\(T\) debe medir en generaciones. Para explicar un reloj molecular de proteínas entre especies que claramente difería drásticamente en el tiempo de generación, se planteó la hipótesis de que la tasa de mutación en realidad se escalaba con el tiempo de generación, es decir, los organismos de corta duración introdujeron menos mutaciones por generación, por ejemplo, ya que tenían menos rondas de mitosis. Esta suposición generación-tiempo significó que la tasa de mutación por año podría ser constante, tal que\(\mu T\) sería una constante para parejas de especies que habían divergido por tiempos geológicos similares, los cuales se miden en años, aunque los organismos difieran en tiempo de generación. Esta suposición permitiría que la teoría neutra fuera consistente con un reloj molecular de proteínas medido en años. Ahora sabemos que esta suposición crítica del tiempo de generación es falsa: los organismos con tiempos de generación más cortos tienen tasas de mutación algo mayores por año por lo que un modelo neutro estricto es inconsistente con el reloj molecular de la proteína. Volveremos a estas ideas cuando discutamos el destino de mutaciones muy débilmente seleccionadas en el Capítulo\ ref {Selection_Stochasticidad} y la teoría Casi Neutral. Si aún estás leyendo esto envía a Graham una foto de Tomoko Ohta recibiendo el Premio Crafoord, un análogo del premio Nobel de biología, por sus contribuciones a la evolución molecular.

    La contribución del polimorfismo ancestral a la divergencia.

    Si estamos considerando\(T\) representar la divergencia entre especies separadas por largo tiempo, entonces podemos pensar en el tiempo en\(T\) que la especie se dividió. Sin embargo, para poblaciones y especies divergentes más recientemente, es necesario incluir el hecho de que la clasificación del polimorfismo ancestral contribuye a la divergencia entre especies. En Figura\ ref {fig:split_anc_pop}, vemos nuestras dos poblaciones divididas hace\(T_s\) generaciones. Sin embargo, la coalescencia de nuestro linaje A y B es necesariamente más profunda en el tiempo que\(T_s\). La mutación superior fue polimórfica en la población ancestral pero ahora contribuye a la divergencia entre A y B. Suponiendo que nuestra población ancestral tenía\(N_A\) individuos de tamaño efectivo, y que nuestras poblaciones se dividieron limpiamente sin flujo génico posterior, entonces

    \[T = T_s + 2N_A.\]

    Si el tiempo de división de nuestra especie es muy grande en comparación con\(2N\) entonces podemos pensar en el tiempo dividido.\(T\)

    [fig:split_anc_pop]

    Ejercicio\(\PageIndex{1}\)

    Para ello, y la siguiente pregunta, supongamos que los humanos y los chimpancés se dividieron alrededor de 5.5\(\times 10^6\) años atrás, tienen un tiempo de generación 20 años, que la especiación ocurrió instantáneamente en alopatría sin flujo génico posterior, y el tamaño de la población efectiva ancestral del humano y chimpancé común la población ancestro fue de 10,000 individuos.

    Nachman y Crowell secuenciaron 12 pseudogenes en humanos y chimpancés y encontraron sustituciones en 1.3% de los sitios.

    1. ¿Cuál es la tasa de mutación por sitio por generación en estos genes?
    2. Todos los pseudogenes que secuenciaron están en los autosomas. Cuál sería su predicción para los pseudogenes en los cromosomas X e Y, dado que pocas mutaciones ocurren en la línea germinal femenina que en la línea germinal masculina por generación.

    Pruebas de evolución molecular

    Uno de los grandes llamamientos de los modelos neutrales es que ofrecen un nulo simple para que probemos datos reales contra.

    Comparando las tasas de sustituciones no sinónimas con sinónimas\(\frac{d_N}{d_S}\)

    Una herramienta común en la evolución molecular es comparar el número estimado (o tasas) de sustituciones en diferentes clases de sitios genómicos, por ejemplo la relación de las tasas de sustituciones no sinónimas (\(d_N\)) a sinónimos (\(d_S\)) en un gen dado. La forma más sencilla de pensar en el cálculo\(d_N\) es contar los cambios no sinónimos y dividir por el número total de posiciones en el gen donde podría ocurrir una mutación puntual no sinónima y luego dividirla por el tiempo. Podemos hacer lo mismo para los cambios sinónimos\(d_S\), y luego tomar la proporción\(\frac{d_N}{d_S}\).

    Para la gran mayoría de los genes codificadores de proteínas en el genoma vemos eso\(\frac{d_N}{d_S} < 1\). Esta observación es consistente con la opinión de que los sitios no sinónimos están mucho más restringidos que los sitios sinónimos, es decir, que la mayoría de las mutaciones no sinónimos son deletéreas y se eliminan rápidamente de la población. Si estamos dispuestos a hacer la suposición de que todos los cambios sinónimos son neutrales\(d_S= \mu\), entonces podemos estimar el grado de restricción en sitios no sinónimos. (Tenga en cuenta que los cambios sinónimos a veces pueden estar sujetos a selección tanto positiva como negativa, pero esta suposición neutral es un punto de partida útil).

    Supongamos que una fracción\(C\) de los cambios no sinónimos son demasiado deletéreos para contribuir a la divergencia, y que no hay mutaciones beneficiosas. Entonces, esperábamos que la tasa de sustituciones neutras no sinónimas sea

    \[d_N = (1-C) \mu\]

    Dividiendo por\(d_S\), encontramos

    \[\frac{d_N}{d_S} = (1-C)\]

    Por lo tanto, si asumimos que las mutaciones no sinónimas solo pueden ser fuertemente deletéreas o neutras, estimamos la fracción de cambios mutacionales que están restringidos por la selección negativa como\(C= 1- \frac{d_N}{d_S}\). C tiene la interpretación de ser la fracción de mutaciones no sinónimas que se eliminan rápidamente de la población por selección, y por lo tanto no contribuyen a la divergencia entre especies.

    Podemos probar si nuestro gen está evolucionando de manera restringida a nivel de proteína estimando\(\frac{d_N}{d_S}\) y probando si esto es significativamente menor que\(1\). Una\(\frac{d_N}{d_S}\) prueba puede proporcionar evidencia evolutiva de que un tramo de ADN propuesto como codificante de proteínas está sujeto a restricciones selectivas y, por lo tanto, probablemente codifica para una proteína funcional. También podemos realizar una\(\frac{d_N}{d_S}\) prueba en ramas específicas de una filogenia para un gen, para probar en qué ramas el gen está sujeto a restricción, o para probar cambios en el nivel de restricción a través de la filogenia.

    Pérdida de restricción a pseudogenes.

    Si bien la mayoría de los genes de proteínas evolucionan bajo restricción, podemos encontrar ejemplos de genes que están evolucionando de una manera mucho menos restringida. El ejemplo más simple de esto es donde el gen ha perdido función. Los genes pueden perder función debido a mutaciones inactivadoras que impiden que se transcriban o traduzcan en proteínas funcionales. Tales genes se llaman 'pseudogenes'. Cuando un gen pierde completamente la función ya no hay selección contra cambios no sinonínicos y así tales mutaciones son tan libres para acumularse como los cambios sinónimos, y así\(\frac{d_N}{d_S}=1\). Los pseudogenes son un maravilloso ejemplo de la extensión de las ideas de Darwin sobre los rasgos vestigiales ('órganos rudimentarios') al nivel del ADN; todavía podemos reconocer una palabra (gen) que alguna vez fue útil cuya ortografía se está degradando lentamente. Nuestros genomas están llenos de antiguos pseudogenes cuyos significados originales (secuencias codificadoras de proteínas funcionales) se erosionan lentamente a través de la acumulación de sustituciones neutras. Un buen ejemplo de un gen que ha perdido repetidamente la función, es decir, volverse psuedogenizado repetidamente, es el gen de la enamlina del estudio de.

    fig-ch01_patchfile_01.jpg
    Ejemplos de mutaciones de desplazamiento de marco (inserciones azules, deleciones rojas) y codones de parada prematuros en enamlin en Cetacea y Xenarthra. Figura de,.

    [fig:Enamlin_coding]

    imagen

    La proteína enamlin es una proteína estructural clave involucrada en la tapa externa del esmalte en los dientes. Diversos mamíferos han evolucionado secundariamente dietas que no requieren dientes duros, por lo que redujeron en gran medida la presión de selección para el esmalte duro, o incluso dientes en absoluto. Por ejemplo, los perezosos de dos dedos (Choloepus), los cachalotes pigmeos (Kogia) y el sarro (Orycteropus) carecen de esmalte en los dientes. Otros mamíferos han perdido sus dientes por completo, por ejemplo, osos hormigueros gigantes (Myrmecophaga) y ballenas barbas. Debido a esta relajación de restricción en el fenotipo, el gen de la enamlin ha acumulado sustituciones pseudogenizantes como codones de parada prematuros y mutaciones de desplazamiento de marco (ver Figura\ ref {fig:Enamlin_coding} para ejemplos). enamlin secuenciado a través de un rango de especies y encontró que ninguna de las especies con esmalte tiene mutaciones de desplazamiento de marco en el esmalte, mientras que 17/20 de las especies que carecen de esmalte o dientes tienen cambios de marco en el esmalte, y todas ellas llevan codones de parada prematuros.

    encontraron que las ramas de la filogenia de la enamlina con un gen funcional de la enamlina tenían un estimado\(\frac{d_N}{d_S}= 0.51\), consistente con la evolución de la proteína de manera restringida. En contraste, las ramas con una Enamlin pseudogenizada tenían\(\frac{d_N}{d_S} = 1.02\), consistente con el gen evolucionando de una manera completamente sin restricciones. Las ramas donde el gen probablemente estaba en transición de un estado funcional a no funcional, es decir, pre-mutación y mezclado, tenían valores intermedios de\(\frac{d_N}{d_S}=0.83-0.98\), consistentes con una transición de un modo restringido a no restringido de evolución de proteínas en algún lugar a lo largo de estas ramas de la filogenia .

    Una interpretación sintética de la historia de la degeneración del esmalte en Tubulidentata (el orden de las varzas aéreas) basada en fósiles, filogenética, relojes moleculares, mutaciones de desplazamiento de marco y relaciones\ frac {D_n} {D_s}. Los cerrojos fósiles más antiguos son O. minutus (19 mya) del Mioceno temprano de Kenia y también carecen de esmalte. Figura & subtitulado modificado de,.
    Interpretación sintética de la historia de la degeneración del esmalte en Tubulidentata (el orden de las varzas aéreas) basada en fósiles, filogenética, relojes moleculares, mutaciones de desplazamiento de marco y\(\frac{d_N}{d_S}\) proporciones. Los hormigueros fósiles más antiguos son O. minutus (19 mya) del Mioceno temprano de Kenia y también carecen de esmalte. Figura & subtitulado modificado de,.

    [Fig:Aardvark_pseudogen]

    imagen

    Ejercicio\(\PageIndex{2}\)

    El gen de la enamlin se pseudogenizó en algún lugar a lo largo de la rama que conduce a Aardvarks (Orycteropus afer), ver Figura\ ref {fig:Aardvark_pseudogene}. estimó que esta rama tiene un\(\frac{d_N}{d_S}=0.75\)

    1. Calcular la restricción promedio contra los cambios de aminoácidos en esta rama.
    2. La última vez que los sardineros compartieron un ancestro común con Afrosoricida (topos dorados, tenrecs) y Macroscelidea (musarañas elefante) hace alrededor de\(\sim 75.1\) millones de años en el Cretácico. Supongamos que para la porción de la rama mientras que el esmalte era funcional\(\frac{d_N}{d_S} = 0.51\) y después de que se pseudogenizó no hubo constaint (i.e.\(\frac{d_N}{d_S} = 1\)). Con base en el promedio de la sucursal\(\frac{d_N}{d_S}=0.75\), ¿se puede estimar el momento en que se pseudogenizó la esmaltina? (Es decir, ¿cuándo está la estrella en la Figura\ ref {fig:Aardvark_pseudogene}?)

    Evolución adaptativa y\(\frac{d_N}{d_S}\)

    Claramente, los genes no solo están sujetos a mutaciones neutras y deletéreas; las mutaciones beneficiosas también deben surgir y fijarse de vez en cuando. Supongamos que una fracción\(B\) de mutaciones no sinónimas que surgen son beneficiosas de tal manera que surgen mutaciones\(2 N \mu B\) beneficiosas por generación. Los alelos benéficos recién surgidos no están destinados a fijarse en la población, ya que pueden perderse por deriva genética cuando son raros en la población (discutiremos cómo calcular la probabilidad de fijación para los alelos beneficiosos en el Capítulo\ ref {Selection_Stochasticidad}). Un alelo benéfico recién surgido alcanza la fijación en la población con probabilidad\(f_B\) a partir de su frecuencia inicial de\(\frac{1}{2N}\). Esta probabilidad de fijación puede ser mucho mayor que la de las mutaciones neutras, pero aún mucho menor que\(1\). La tasa total esperada de sustituciones no sinónimas es

    \[dN= (1-C - B) \mu + (2 N \mu B) \times f_B.\]

    Entonces

    \[\frac{d_N}{d_S} = (1-C-B) + 2 N B f_B \label{eqn:dNDS_C_B}\]

    asumiendo de nuevo que todas las mutaciones sinónimas son neutras. Tenga en cuenta que esto significa que nuestras estimaciones de\(C\) uso\(1-\frac{d_N}{d_S}\) serán un límite inferior en la restricción verdadera si incluso una pequeña fracción de mutaciones son beneficiosas. Aquellos casos en los que el gen está evolucionando más rápidamente a nivel de proteína que en sitios sinónimos, es decir\(d_N/d_S > 1\), son candidatos potencialmente fuertes para la selección positiva impulsando rápidamente el cambio a nivel de proteína. Podemos identificar genes que tienen\(\frac{d_N}{d_S}\) significativamente mayor que uno, ya sea en la filogenia completa del gen, o en ramas particulares. Nótese que es una prueba muy conservadora que pocos genes en el genoma encuentran, ya que muchos genes que están fijando sustituciones adaptativas no sinónimas tendrán\(\frac{d_N}{d_S}<1\); incluso si las mutaciones adaptativas son comunes, los genes aún pueden evolucionar de manera restringida (es decir\(\frac{d_N}{d_S}<1\)) si la fijación rápida de mutaciones beneficiosas debido a la selección positiva es superada por la pérdida de mutaciones no sinónimas a selección negativa.

    fig-ch01_patchfile_01.jpg
    Un filograma para el gen de la lisozima de primate, datos de. Para cada rama, los números dan el número promedio estimado de cambios no sinónimos a sinónimos en la proteína de lisozima.

    imagen

    Un ejemplo clásico para observar la evolución adaptativa usando\(\frac{d_N}{d_S}\) es la evolución del gen de la lisozima en primates. La proteína lisozima es un componente clave para la descomposición de las paredes bacterianas. El gen de la lisozima muestra una evolución proteica muy rápida (ver la filogenia en la Figura 1.1), notablemente en los linajes que conducen a simios (por ejemplo, gibones y humanos) y Colobinas (por ejemplo, monos colobus y langur). Las colobinas tienen dietas a base de hojas. Ellos digieren estas hojas por fermentación bacteriana en su intestino anterior, y luego usan lisozimas para descomponer las bacterias y extraer energía de las hojas. En Colobinas, la proteína de lisozima ha evolucionado para funcionar bien en el ambiente de pH alto del estómago. Sorprendentemente, la proteína de lisozima Colobina ha evolucionado convergentemente esta actividad a través de cambios de aminoácidos muy similares en 5 residuos clave en vacas y Hoatzins

    imagen

    La prueba de McDonald-Kreitman

    Como se señaló anteriormente, un gran problema con el uso\(\frac{d_N}{d_S}\) para detectar la adaptación es que es muy conservadora. Para una prueba más poderosa de divergencia rápida, lo que tenemos que hacer es ajustarnos al nivel de restricción que experimenta un gen en sitios no sinónimos. Una forma de hacerlo es usar los datos de polimorfismo como control interno. Si vemos poco polimorfismo no sinónimo en un gen, pero mucho polimorfismo sinónimo, ahora sabemos que probablemente hay una fuerte restricción en el gen (es decir, alta\(C\)), por lo que esperamos\(\frac{d_N}{d_S}\) que sea baja. ideó una prueba simple de la teoría neutra de la evolución molecular en un gen basado en esta intuición. Tomó el caso donde tenemos datos de polimorfismo en un gen para una especie y divergencia a una especie estrechamente relacionada. Dividieron el polimorfismo y fijaron las diferencias en su muestra en el número de cambios no sinónimos y sinónimos:

      Poli. Fijo
    No Syn. \(P_N\) \(D_N\)
    Syn. \(P_S\) \(D_S\)
    Ratio \(P_N/P_S\) \(D_N/D_S\)

    [Fig:MK_tree]

    Bajo la teoría neutral, esperamos un número menor de diferencias fijas no sinónimos a sinónimos (\(D_N/D_S < 1\)) y exactamente la misma expectativa se mantiene para el polimorfismo (\(P_N/P_S\)). Consideremos un gen con\(L_S\) y\(L_N\) sitios donde podrían surgir mutaciones sinónimas y no sinónimas respectivamente. Podemos pensar en la genealogía genética subyacente en nuestro gen, ver Figura\ ref {fig:MK_Tree}, con el tiempo total en la genealogía coalescente dentro de la especie como\(T_{tot}\) y el tiempo total para diferencias fijas entre nuestras especies como\(T_{div}'\), tenga en cuenta que\(T_{div}'\) es el tiempo total donde podría surgir un alelo que aparecería como una subsitución. Entonces bajo neutralidad esperamos polimorfismos\(\mu L_N (1-C) T_{tot}\) no sinónimos (es decir, nuestro número de sitios segregantes), y diferencias fijas\(\mu L_N (1-C) T_{div}'\) no sinónimas. Luego podemos llenar el resto de nuestra tabla de la siguiente manera:

      Poli. Fijo
    No Syn. \(\mu L_N (1-C) T_{tot}\) \(\mu L_N (1-C) T_{div}'\)
    Syn. \(\mu L_S T_{tot}\) \(\mu L_S T_{div}'\)
    Ratio \(L_N(1-C)/( L_S)\) \(L_N (1-C) / ( L_S)\)

    Por lo tanto, esperamos que la proporción de cambios no sinónimos a sinónimos sea la misma para polimorfismo y divergencia bajo un estricto modelo neutro. Podemos probar esta expectativa de proporciones iguales a través de las pruebas estándar de una\(2 \times 2\) tabla. Si la relación de\(N/S\) es significativamente mayor para la divergencia que para el polimorfismo, tenemos evidencia de que las sustituciones no sinónimos se están acumulando más rápidamente de lo que predeciríamos determinados niveles de restricción solos.

    Como ejemplo de una tabla Mcdonald-Kreitman (MK) considerar el trabajo de sobre la evolución molecular de la opsina fotopigmentaria L en mariposas almirante (Limenitis), responsables de la visión del color en la parte de longitud de onda larga del espectro visual. encontró que la sensibilidad de esta opsina tenía se desplazó hacia el azul en su sensibilidad en L. archippus archippus (virrey) en comparación con L. arthemis astyanax. Para probar si esta evolución molecular reflejó selección positiva, secuenciaron 24 individuos de L. arthemis astyanax y una secuencia de L. archippus archippus. Identificaron 11 sitios polimórficos en L. arthemis astyanax y 16 diferencias fijas, que se descomponen de la siguiente manera:

    imagen

      Poli. Fijo
    No Syn. \(2\) \(12\)
    Syn. \(9\) \(4\)
    Ratio \(\frac{2}{9}\) \(\frac{3}{1}\)

    Obsérvese el fuerte exceso de divergencia no sinónimo a sinónimo en comparación con el polimorfismo (valor p de\(0.006\), prueba exacta de Fisher), lo cual es consistente con la evolución del gen de manera adaptativa entre las dos especies. Esperaríamos aproximadamente solo sustituciones\(3\) no sinónimas de 16 sustituciones si el gen evolucionara neutralmente (\(16 \times \frac{2}{11}\)).

    Resumen

    • En una población diploide de tamaño\(N\), cualquiera de un conjunto de alelos\(2N\) selectivamente equivalentes (es decir, neutros) es igualmente probable que sea el antepasado de toda la población en algún momento lejano futuro. Por lo tanto, la probabilidad de que una nueva mutación eventualmente se fije en la población es\(\frac{1}{2N}\).
    • Bajo un modelo donde una fracción\(C\) de nuevas mutaciones son neutras y\(1-C\) las mutaciones son fuertemente deletéreas, surgen\(2NC\mu\) mutaciones de cada generación que posiblemente pueden convertirse en sustituciones. Por lo tanto, la tasa por generación de sustitución neutra es\(2N(1-C)\mu \times \frac{1}{2N} = (1-C)\mu\). Esto es independiente del tamaño de la población y solo depende de los niveles de restricción y las tasas de mutación.
    • La tasa constante de sustitución neutra da lugar a un reloj molecular por generación, que potencialmente puede usarse para estimar las tasas de restricción (\(C\)) y mutación.
    • Muchos resúmenes y pruebas de evolución molecular, por ejemplo\(\frac{d_N}{d_S}\), se basan en la comparación de tasas de sustitución entre clases funcionales de sitios. Estos permiten identificar diferentes niveles de restricción y detectar señales de sustitución adaptativa.
    • Las pruebas de evolución molecular para adaptación que también incorporan divergencia y polimorfismo, por ejemplo la prueba de Mcdonald-Kreitman, son herramientas potencialmente poderosas ya que los niveles de polimorfismo permiten una medida algo independiente de los niveles de restricción.
    Ejercicio\(\PageIndex{3}\)

    Suponiendo que la tasa de mutación es\(\mu\) /gamete/generación y el tamaño de la población es N individuos diploides, ¿cuál es el número de nuevas mutaciones introducidas en la población en cada generación?

    Ejercicio\(\PageIndex{4}\)

    ¿Cuál es la probabilidad de fijación de una nueva mutación neutra única en una población de N individuos haploides?

    Ejercicio\(\PageIndex{5}\)

    ¿Por qué el DN/ds es mucho menor que uno para la mayoría de los genes de nuestro genoma?

    Ejercicio\(\PageIndex{6}\)

    Secuencias un gen en Drosophila melanogaster y D. simulans. Se observan 5 sustituciones no sinónimos de 500 bases donde podrían ocurrir sustituciones no sinónimos, y 15 sustituciones sinónimos de 500 bases donde podrían ocurrir sustituciones sinónimos. ¿Cuál es el nivel de restricción en sitios no sinónimos?

    Ejercicio\(\PageIndex{7}\)

    Al analizar los datos de polimorfismo y divergencia para un gen, se calcula la siguiente tabla de McDonald-Kreitman.

      Polimorpo. Fijo
    Sinónimo 40 80
    No sinónimo 20 80
    1. Con base en la proporción de polimorfismos no sinónimos a sinónimos, y dadas las 80 sustituciones sinónimas, ¿cuántas sustituciones no sinónimas esperarías si este gen evolucionara de manera neutra?
    2. ¿Esta tabla es consistente con la evolución del gen de manera neutra? Si no, ¿qué podría explicar los resultados?

    This page titled 5: Genética poblacional de divergencia y sustitución molecular is shared under a CC BY 3.0 license and was authored, remixed, and/or curated by Graham Coop via source content that was edited to the style and standards of the LibreTexts platform; a detailed edit history is available upon request.