Saltar al contenido principal
LibreTexts Español

12.4: Inserción de Alu (Actividad)

  • Page ID
    56386
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\ket}[1]{\left| #1 \right>}\)
    \(\newcommand{\bra}[1]{\left< #1 \right|}\)
    \(\newcommand{\braket}[2]{\left< #1 \vphantom{#2} \right| \left. #2 \vphantom{#1} \right>}\)
    \(\newcommand{\braopket}[3]{\left< #1 \vphantom{#2}\vphantom{#3} \right| #2 \vphantom{#1}\vphantom{#3} \left| #3 \vphantom{#1}\vphantom{#2} \right>}\)
    \(\newcommand{\qmvec}[1]{\mathbf{\vec{#1}}}\)
    \(\newcommand{\op}[1]{\hat{\mathbf{#1}}}\)
    \(\newcommand{\expect}[1]{\langle #1 \rangle}\)
    \(\newcommand{\dfn}[1]{\emph{\textbf{#1}}}\)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    Los alu' s son SINE únicos que aparecen en el linaje de primates y revelan el linaje y diversificación de primates. Si bien los retrotransposones pueden alterar genes (como en algunos casos de hemofilia), a menudo aterrizan fuera de los genes o dentro de intrones sin efecto. Un ejemplo de un elemento Alu no disruptivo en humanos se encuentra en la ubicación llamada PV92 en el cromosoma 16. Este elemento es de la subfamilia más joven de Alu, llamada Ya5.

    Dado que el PV92 no causa ningún efecto perjudicial, se puede utilizar como marcador no seleccionado para ilustrar el linaje. Algunas personas tienen un elemento Alu en su ubicación mientras que otras no. La presencia o ausencia de este marcador es vista como un alelo. Este laboratorio utiliza un cebador que flanquea la ubicación de la inserción de Alu que abarcan 416 pb. Si está presente un Alu, el ADN amplificado será 300 pb más grande (el tamaño de un Alu) a 731 pb.

    Ejercicio: PCR en silico de PV92

    Cebador directo: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′ Cebador
    inverso: 5′ GAAAGGCAAGCTACCAGAAGCCAAGCCAA 3′

    1. Realizar Ejercicio Informático/Discusión de PCR Virtual.
    2. Visita BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
    3. Pegar ambas imprimaciones: GGATCTCAGGGTGGGTGGCAATGCT GAAAGGCAAGCTACCAGAAGCCAAAGCCAA
    4. Elija “Algo similar”
      1. Localizar el lugar del producto y el tamaño.

    5. Encuentra los fragmentos de PCR en Ugene

    1. Descargar el archivo FASTA de muestra: Muestra PV92
    2. Abra el archivo en Ugene y seleccione la opción “Como secuencias separadas en el visor”
    3. Seleccione el botón “In Silico PCR” en el extremo derecho (botón de doble hélice) e inserte los cebadores

    primerbutton

    4. Se debe anotar un producto de PCR para una de las secuencias después de presionar “Buscar productos de todos modos”

    5. Haga clic en la segunda secuencia en el visor y presione “Buscar productos de todos modos”

    Ejercicio: PCR Genotipo PV92 Locus

    1. PCR de las muestras individuales.
    2. Vierta 2% de agarosa en el aparato de fundición en el refrigerador.
    • Se necesitan hacer 2 geles por clase → 100ml de TBE con agarosa 2g.
    • Agregue 5μl de solución segura SYBR en la agarosa fundida antes de colar.
    • Coloca 2 juegos de peines en el gel → en un extremo y en el medio.
    1. Cargar muestras de escalera de ADN y PCR.
    2. Ejecute el gel a 120V por 30 minutos.
    3. Visualizar en transiluminador UV.
    4. Calificar geles para la presencia/ausencia de los alelos para determinar la frecuencia del genotipo en la clase.

    This page titled 12.4: Inserción de Alu (Actividad) was last modified on Sat, 29 Oct 2022 22:43:45 GMT and is shared under a CC BY-NC-SA 4.0 license and was authored, remixed, and/or curated by Bio-OER.