Saltar al contenido principal
LibreTexts Español

16.1: Introducción

  • Page ID
    56327
  • \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \( \newcommand{\dsum}{\displaystyle\sum\limits} \)

    \( \newcommand{\dint}{\displaystyle\int\limits} \)

    \( \newcommand{\dlim}{\displaystyle\lim\limits} \)

    \( \newcommand{\id}{\mathrm{id}}\) \( \newcommand{\Span}{\mathrm{span}}\)

    ( \newcommand{\kernel}{\mathrm{null}\,}\) \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\) \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\) \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\id}{\mathrm{id}}\)

    \( \newcommand{\Span}{\mathrm{span}}\)

    \( \newcommand{\kernel}{\mathrm{null}\,}\)

    \( \newcommand{\range}{\mathrm{range}\,}\)

    \( \newcommand{\RealPart}{\mathrm{Re}}\)

    \( \newcommand{\ImaginaryPart}{\mathrm{Im}}\)

    \( \newcommand{\Argument}{\mathrm{Arg}}\)

    \( \newcommand{\norm}[1]{\| #1 \|}\)

    \( \newcommand{\inner}[2]{\langle #1, #2 \rangle}\)

    \( \newcommand{\Span}{\mathrm{span}}\) \( \newcommand{\AA}{\unicode[.8,0]{x212B}}\)

    \( \newcommand{\vectorA}[1]{\vec{#1}}      % arrow\)

    \( \newcommand{\vectorAt}[1]{\vec{\text{#1}}}      % arrow\)

    \( \newcommand{\vectorB}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \( \newcommand{\vectorC}[1]{\textbf{#1}} \)

    \( \newcommand{\vectorD}[1]{\overrightarrow{#1}} \)

    \( \newcommand{\vectorDt}[1]{\overrightarrow{\text{#1}}} \)

    \( \newcommand{\vectE}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash{\mathbf {#1}}}} \)

    \( \newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} } \)

    \(\newcommand{\longvect}{\overrightarrow}\)

    \( \newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}} \)

    \(\newcommand{\ket}[1]{\left| #1 \right>}\)
    \(\newcommand{\bra}[1]{\left< #1 \right|}\)
    \(\newcommand{\braket}[2]{\left< #1 \vphantom{#2} \right| \left. #2 \vphantom{#1} \right>}\)
    \(\newcommand{\braopket}[3]{\left< #1 \vphantom{#2}\vphantom{#3} \right| #2 \vphantom{#1}\vphantom{#3} \left| #3 \vphantom{#1}\vphantom{#2} \right>}\)
    \(\newcommand{\qmvec}[1]{\mathbf{\vec{#1}}}\)
    \(\newcommand{\op}[1]{\hat{\mathbf{#1}}}\)
    \(\newcommand{\expect}[1]{\langle #1 \rangle}\)
    \(\newcommand{\dfn}[1]{\emph{\textbf{#1}}}\)

    \(\newcommand{\avec}{\mathbf a}\) \(\newcommand{\bvec}{\mathbf b}\) \(\newcommand{\cvec}{\mathbf c}\) \(\newcommand{\dvec}{\mathbf d}\) \(\newcommand{\dtil}{\widetilde{\mathbf d}}\) \(\newcommand{\evec}{\mathbf e}\) \(\newcommand{\fvec}{\mathbf f}\) \(\newcommand{\nvec}{\mathbf n}\) \(\newcommand{\pvec}{\mathbf p}\) \(\newcommand{\qvec}{\mathbf q}\) \(\newcommand{\svec}{\mathbf s}\) \(\newcommand{\tvec}{\mathbf t}\) \(\newcommand{\uvec}{\mathbf u}\) \(\newcommand{\vvec}{\mathbf v}\) \(\newcommand{\wvec}{\mathbf w}\) \(\newcommand{\xvec}{\mathbf x}\) \(\newcommand{\yvec}{\mathbf y}\) \(\newcommand{\zvec}{\mathbf z}\) \(\newcommand{\rvec}{\mathbf r}\) \(\newcommand{\mvec}{\mathbf m}\) \(\newcommand{\zerovec}{\mathbf 0}\) \(\newcommand{\onevec}{\mathbf 1}\) \(\newcommand{\real}{\mathbb R}\) \(\newcommand{\twovec}[2]{\left[\begin{array}{r}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\ctwovec}[2]{\left[\begin{array}{c}#1 \\ #2 \end{array}\right]}\) \(\newcommand{\threevec}[3]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\cthreevec}[3]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \end{array}\right]}\) \(\newcommand{\fourvec}[4]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\cfourvec}[4]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \end{array}\right]}\) \(\newcommand{\fivevec}[5]{\left[\begin{array}{r}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\cfivevec}[5]{\left[\begin{array}{c}#1 \\ #2 \\ #3 \\ #4 \\ #5 \\ \end{array}\right]}\) \(\newcommand{\mattwo}[4]{\left[\begin{array}{rr}#1 \amp #2 \\ #3 \amp #4 \\ \end{array}\right]}\) \(\newcommand{\laspan}[1]{\text{Span}\{#1\}}\) \(\newcommand{\bcal}{\cal B}\) \(\newcommand{\ccal}{\cal C}\) \(\newcommand{\scal}{\cal S}\) \(\newcommand{\wcal}{\cal W}\) \(\newcommand{\ecal}{\cal E}\) \(\newcommand{\coords}[2]{\left\{#1\right\}_{#2}}\) \(\newcommand{\gray}[1]{\color{gray}{#1}}\) \(\newcommand{\lgray}[1]{\color{lightgray}{#1}}\) \(\newcommand{\rank}{\operatorname{rank}}\) \(\newcommand{\row}{\text{Row}}\) \(\newcommand{\col}{\text{Col}}\) \(\renewcommand{\row}{\text{Row}}\) \(\newcommand{\nul}{\text{Nul}}\) \(\newcommand{\var}{\text{Var}}\) \(\newcommand{\corr}{\text{corr}}\) \(\newcommand{\len}[1]{\left|#1\right|}\) \(\newcommand{\bbar}{\overline{\bvec}}\) \(\newcommand{\bhat}{\widehat{\bvec}}\) \(\newcommand{\bperp}{\bvec^\perp}\) \(\newcommand{\xhat}{\widehat{\xvec}}\) \(\newcommand{\vhat}{\widehat{\vvec}}\) \(\newcommand{\uhat}{\widehat{\uvec}}\) \(\newcommand{\what}{\widehat{\wvec}}\) \(\newcommand{\Sighat}{\widehat{\Sigma}}\) \(\newcommand{\lt}{<}\) \(\newcommand{\gt}{>}\) \(\newcommand{\amp}{&}\) \(\definecolor{fillinmathshade}{gray}{0.9}\)

    Formato FASTA

    Las secuencias biológicas se pasan al software en un formato estandarizado denominado FASTA. FASTA es un formato de texto plano que se puede leer en cualquier editor de texto (TextEdit, Bloc de notas, VIM, TextWrangler, etc.). Los ácidos nucleicos (ADN y ARN) y las proteínas están representados por nucleótidos de una sola letra (A, T, C, G) o aminoácidos de una sola letra (20 aminoácidos). Las secuencias FASTA comienzan con un carácter > en la primera línea seguido de alguna información descriptiva sobre la secuencia, como un nombre de secuencia. La siguiente línea consiste en la información de secuencia. Un archivo FASTA puede contener múltiples entradas de secuencia, todas delimitadas por una nueva línea y una línea de título que comienza con >.


    Archivo FASTA de ejemplo

    > Secuencia de ácidos nucleicos maquillado
    ATATAGGGATTAGGATTAGGATTAGGATAGGGGATTGCGCCG
    > Otra secuencia de ácido nucleico en el mismo archivo
    GGGTCGGGCTAGCGGAATCGGATTCGGCATTCGGATATCGGATATCGGATTCGGATTCGGAT


    Los archivos FASTA son de texto plano pero suelen tener una extensión que lo indica como archivo de secuencia: .fasta, .fa, .fna o incluso .txt

    A continuación se muestra una lista de códigos de una sola letra para ácidos nucleicos:

    Código de ácido nucleico Significado Mnemotécnico
    A A A denine
    C C C ytosina
    G G G uanina
    T T T himino
    U U U racil
    R A o G pu R ine
    Y C, T o U p Y rimidinas
    K G, T o U bases que son K etones
    M A o C bases con grupos M ino
    S C o G Interacción S trong
    W A, T o U Interacción W eak
    B no A (es decir, C, G, T o U) B viene después de A
    D no C (es decir, A, G, T o U) D viene después de C
    H no G (es decir, A, C, T o U) H viene después de G
    V ni T ni U (es decir, A, C o G) V viene después de U
    N A, C, G, T, U N ucleótido
    X enmascarado
    — Brecha de longitud indeterminada

    Manipulación gráfica de secuencias

    Los ejercicios aquí descritos con respecto a la bioinformática utilizarán un software libre y de código abierto llamado Unipro UGENE.


    This page titled 16.1: Introducción was last modified on Sat, 29 Oct 2022 22:42:37 GMT and is shared under a CC BY-NC-SA 4.0 license and was authored, remixed, and/or curated by Bio-OER.